1. Skip to navigation
  2. Skip to content
  3. Skip to sidebar


orbilia23's Snapshots

Go to page:
  1. Apothecia

    Snapshot Title: Apothecia
    Taken by: orbilia23

    Image: Pithya vulgaris #2
    Image Owner: orbilia23



    Description:

    all around



  2. Jerry..

    Snapshot Title: Jerry..
    Taken by: orbilia23

    Image: Pithya vulgaris #2
    Image Owner: orbilia23



    Description:

    kenns de deen doten?



  3. Pithya vulgaris

    Snapshot Title: Pithya vulgaris
    Taken by: orbilia23

    Image: Pithya vulgaris #1
    Image Owner: orbilia23



    Description:

    apothecia



  4. apothecia

    Snapshot Title: apothecia
    Taken by: orbilia23

    Image: Pithya vulgaris #2
    Image Owner: orbilia23



    Description:

    on Abies nordmanniana



  5. apothecia

    Snapshot Title: apothecia
    Taken by: orbilia23

    Image: Pithya vulgaris #1
    Image Owner: orbilia23



    Description:

    fromPithya vulgaris



  6. Apothecia

    Snapshot Title: Apothecia
    Taken by: orbilia23

    Image: Orbilia frangulae (nom. prov.)
    Image Owner: orbilia23



    Description:

    of Orbilia frangulae



  7. apo used for microscopy

    Snapshot Title: apo used for microscopy
    Taken by: orbilia23

    Image: Orbilia xanthostigma (3d and 2D)
    Image Owner: orbilia23



    Description:

    .



  8. grapher

    Snapshot Title: grapher
    Taken by: orbilia23

    Image: Le-Buisson-de-Cadouin (#4)
    Image Owner: julibrot



    Description:

    .?.



  9. Species table

    Snapshot Title: Species table
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    quick overview



  10. highly specific ITS2

    Snapshot Title: highly specific ITS2
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    internal transcribed spacer 2 (pp)



  11. End of the Large Subunit (LSU)

    Snapshot Title: End of the Large Subunit (LSU)
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    the domain #12 ends with ATC TGC TGA.
    Following the LSU comes the IGS1 (intergenic spacer #1) which is highly specific, somewhat chaotic and difficult to align.



  12. LR20R Primer site

    Snapshot Title: LR20R Primer site
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    LR20R (5´GTGAGACAGGTTAGTTTTACCCT 3´)



  13. end of this intron

    Snapshot Title: end of this intron
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    left of AAT AGG GAA CGT



  14. Intron between LR11(R) and LR20R

    Snapshot Title: Intron between LR11(R) and LR20R
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    it starts after TCA CCC ACT



  15. interesting primer zone

    Snapshot Title: interesting primer zone
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    between 2 introns



  16. Intron inside Primer LR11(R)

    Snapshot Title: Intron inside Primer LR11(R)
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    the intron ends left of AAC TGG CTT GTG



  17. An Intron splits the primer LR11

    Snapshot Title: An Intron splits the primer LR11
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    the primer LR11R (5´ TTACCACAGGGATAACTGGC 3´) bears an intron inside.



  18. Primer
  19. Intron inside Primer LR10R

    Snapshot Title: Intron inside Primer LR10R
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    this intron (after GAA GAC CCT) splits the primer LR10R (5´CCCTGTTGAGCTTGACT 3´)



  20. end of D9 Intron

    Snapshot Title: end of D9 Intron
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    left of AAG GTA GCC AAA



  21. LSU D9 Intron site

    Snapshot Title: LSU D9 Intron site
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    the intron begins after CTA TGA CTC



  22. LR9R Primer site

    Snapshot Title: LR9R Primer site
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    LR9R (5´ TTTCTGCCCAGTGCTCT 3´)



  23. LR8R Primer site

    Snapshot Title: LR8R Primer site
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    LR8R 5´AGCAGGTCTCCAAGGTG 3´)



  24. LR7R Primer site

    Snapshot Title: LR7R Primer site
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    LR7R (5´ GCAGATCTTGGTGGTAG 3´)



  25. LSU D6 Intron

    Snapshot Title: LSU D6 Intron
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    ending left of AAA AGG TGT



  26. Intron in the D6 of LSU

    Snapshot Title: Intron in the D6 of LSU
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    after AGAYACCAY (mostly AGACACCAC)



  27. LR6R Primer site

    Snapshot Title: LR6R Primer site
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    5´ TAAGCAGAACTGGCGATG 3´



  28. end of the large LSU-D4 Intron

    Snapshot Title: end of the large LSU-D4 Intron
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    at CTRGTA (mostly CTAGTA)



  29. first large Intron in the D4 of LSU

    Snapshot Title: first large Intron in the D4 of LSU
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    starts after ACTAATCGAAYCWT



  30. small intron

    Snapshot Title: small intron
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    very rare intron between GAAAGRT and GGTGARCT



  31. Domain 2 of the LSU

    Snapshot Title: Domain 2 of the LSU
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    is ending left of the Primer LR3R (5´ CCCGTCTTGAAACACGG 3´)



  32. Start of the Large Subunit (LSU)

    Snapshot Title: Start of the Large Subunit (LSU)
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    after TTGACCT
    or TGGACCT or TCGACCT



  33. end of 5.8S

    Snapshot Title: end of 5.8S
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    GAGCGTC for Ascomycota, GAGTGTCA for Basidiomycota



  34. 5.8S gene

    Snapshot Title: 5.8S gene
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    begins with AAACTTT (ACAACTTT for Basidiomycota)



  35. ITS1

    Snapshot Title: ITS1
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    internal transcribed spacer 1, begins after ATCATTA



  36. ITS1-F primer site

    Snapshot Title: ITS1-F primer site
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    ITS1-F (5´CTTGGTCATTTAGAGGAAGTAA 3´)



  37. Intron site

    Snapshot Title: Intron site
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    after (at the right hand side)CAAGGT



  38. apothecia

    Snapshot Title: apothecia
    Taken by: orbilia23

    Image: Bisporella confluens
    Image Owner: orbilia23



    Description:

    of Bisporella confluens



  39. selfie

    Snapshot Title: selfie
    Taken by: orbilia23

    Image: Дербент
    Image Owner: Vitaly Kurennoy



    Description:

    taking



  40. Dematiaceous hyphomycetes

    Snapshot Title: Dematiaceous hyphomycetes
    Taken by: orbilia23

    Image: Grand View, Canyonlands NP
    Image Owner: Stephen Dymmock



    Description:

    inhabiting in huge masses these rocks



Go to page: