1. Skip to navigation
  2. Skip to content
  3. Skip to sidebar


orbilia23's Snapshots

Go to page:
  1. slag line :)

    Snapshot Title: slag line :)
    Taken by: orbilia23

    Image: Encoelia populnea
    Image Owner: orbilia23



    Description:

    woven by a spider..



  2. La Beaume

    Snapshot Title: La Beaume
    Taken by: orbilia23

    Image: La Beaume
    Image Owner: orbilia23



    Description:

    last houses



  3. collection site #1515

    Snapshot Title: collection site #1515
    Taken by: orbilia23

    Image: La Beaume
    Image Owner: orbilia23



    Description:

    La Beaume.fr



  4. apothecia

    Snapshot Title: apothecia
    Taken by: orbilia23

    Image: Hysteropatella prostii
    Image Owner: orbilia23



    Description:

    in a +/- wet state



  5. good camouflage

    Snapshot Title: good camouflage
    Taken by: orbilia23

    Image: Hysteropatella prostii
    Image Owner: orbilia23



    Description:

    dark apothecia of Hysteropatella prostii on the inner bark of apple trees



  6. mite

    Snapshot Title: mite
    Taken by: orbilia23

    Image: Patellariopsis atrovinosa
    Image Owner: orbilia23



    Description:

    probably dead



  7. young apothecia

    Snapshot Title: young apothecia
    Taken by: orbilia23

    Image: Patellariopsis atrovinosa
    Image Owner: orbilia23



    Description:

    .



  8. the anamorph

    Snapshot Title: the anamorph
    Taken by: orbilia23

    Image: Patellariopsis atrovinosa
    Image Owner: orbilia23



    Description:

    of Patellariopsis atrovinosa



  9. apothecia

    Snapshot Title: apothecia
    Taken by: orbilia23

    Image: Patellariopsis atrovinosa
    Image Owner: orbilia23



    Description:

    .



  10. Attention

    Snapshot Title: Attention
    Taken by: orbilia23

    Image: Orbilia poitevinia (nom. prov.)
    Image Owner: orbilia23



    Description:

    loose bark protrudes the 3D window and pops out of your screen ;).



  11. apothecia

    Snapshot Title: apothecia
    Taken by: orbilia23

    Image: Orbilia poitevinia (nom. prov.)
    Image Owner: orbilia23



    Description:

    growing on bast.



  12. another broken

    Snapshot Title: another broken
    Taken by: orbilia23

    Image: The habitat of Encoelia fascicularis
    Image Owner: orbilia23



    Description:

    Salix caprea. Hard to believe, but this one is still living.



  13. broken

    Snapshot Title: broken
    Taken by: orbilia23

    Image: The habitat of Encoelia fascicularis
    Image Owner: orbilia23



    Description:

    Salix caprea



  14. broken

    Snapshot Title: broken
    Taken by: orbilia23

    Image: The habitat of Encoelia fascicularis
    Image Owner: orbilia23



    Description:

    Populus tremula



  15. young apothecia

    Snapshot Title: young apothecia
    Taken by: orbilia23

    Image: Encoelia populnea
    Image Owner: orbilia23



    Description:

    .



  16. Mesquite flat

    Snapshot Title: Mesquite flat
    Taken by: orbilia23

    Image: Alluvial Fans - Sunny
    Image Owner: Ron Schott



    Description:

    nearby Stovepipe Wells (IMHO)



  17. Apothecia on bast

    Snapshot Title: Apothecia on bast
    Taken by: orbilia23

    Image: Claussenomyces sp. from Casamance, Senegal
    Image Owner: orbilia23



    Description:

    and on epidermis



  18. these blackish apothecia

    Snapshot Title: these blackish apothecia
    Taken by: orbilia23

    Image: Claussenomyces sp. from Casamance, Senegal
    Image Owner: orbilia23



    Description:

    .. are actually blue under the microscope.



  19. Apothecia

    Snapshot Title: Apothecia
    Taken by: orbilia23

    Image: Claussenomyces sp. from Casamance, Senegal
    Image Owner: orbilia23



    Description:

    on bark and bast



  20. apothecia

    Snapshot Title: apothecia
    Taken by: orbilia23

    Image: Encoelia populnea (Roost.lu)
    Image Owner: orbilia23



    Description:

    from 5 - 10 mm diam.



  21. Encoelia populnea

    Snapshot Title: Encoelia populnea
    Taken by: orbilia23

    Image: Encoelia populnea (Roost.lu)
    Image Owner: orbilia23



    Description:

    or E. fascicularis on Populus tremula branches.



  22. seldom seen,

    Snapshot Title: seldom seen,
    Taken by: orbilia23

    Image: Death Valley Spring
    Image Owner: John Toeppen



    Description:

    bright green leaves of Creosote bush after an inch of rainfall. The Mojave desert is an amazing place on earth. Thanks John!



  23. Apothecia

    Snapshot Title: Apothecia
    Taken by: orbilia23

    Image: Pithya vulgaris #2
    Image Owner: orbilia23



    Description:

    all around



  24. Jerry..

    Snapshot Title: Jerry..
    Taken by: orbilia23

    Image: Pithya vulgaris #2
    Image Owner: orbilia23



    Description:

    kenns de deen doten?



  25. Pithya vulgaris

    Snapshot Title: Pithya vulgaris
    Taken by: orbilia23

    Image: Pithya vulgaris #1
    Image Owner: orbilia23



    Description:

    apothecia



  26. apothecia

    Snapshot Title: apothecia
    Taken by: orbilia23

    Image: Pithya vulgaris #2
    Image Owner: orbilia23



    Description:

    on Abies nordmanniana



  27. apothecia

    Snapshot Title: apothecia
    Taken by: orbilia23

    Image: Pithya vulgaris #1
    Image Owner: orbilia23



    Description:

    fromPithya vulgaris



  28. Apothecia

    Snapshot Title: Apothecia
    Taken by: orbilia23

    Image: Orbilia frangulae (nom. prov.)
    Image Owner: orbilia23



    Description:

    of Orbilia frangulae



  29. apo used for microscopy

    Snapshot Title: apo used for microscopy
    Taken by: orbilia23

    Image: Orbilia xanthostigma (3d and 2D)
    Image Owner: orbilia23



    Description:

    .



  30. grapher

    Snapshot Title: grapher
    Taken by: orbilia23

    Image: Le-Buisson-de-Cadouin (#4)
    Image Owner: julibrot



    Description:

    .?.



  31. Species table

    Snapshot Title: Species table
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    quick overview



  32. highly specific ITS2

    Snapshot Title: highly specific ITS2
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    internal transcribed spacer 2 (pp)



  33. End of the Large Subunit (LSU)

    Snapshot Title: End of the Large Subunit (LSU)
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    the domain #12 ends with ATC TGC TGA.
    Following the LSU comes the IGS1 (intergenic spacer #1) which is highly specific, somewhat chaotic and difficult to align.



  34. LR20R Primer site

    Snapshot Title: LR20R Primer site
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    LR20R (5´GTGAGACAGGTTAGTTTTACCCT 3´)



  35. end of this intron

    Snapshot Title: end of this intron
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    left of AAT AGG GAA CGT



  36. Intron between LR11(R) and LR20R

    Snapshot Title: Intron between LR11(R) and LR20R
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    it starts after TCA CCC ACT



  37. interesting primer zone

    Snapshot Title: interesting primer zone
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    between 2 introns



  38. Intron inside Primer LR11(R)

    Snapshot Title: Intron inside Primer LR11(R)
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    the intron ends left of AAC TGG CTT GTG



  39. An Intron splits the primer LR11

    Snapshot Title: An Intron splits the primer LR11
    Taken by: orbilia23

    Image: Intron sites of the Small Subunit (SSU) and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA)
    Image Owner: orbilia23



    Description:

    the primer LR11R (5´ TTACCACAGGGATAACTGGC 3´) bears an intron inside.



  40. Primer
Go to page: